Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10343H8
Clone ID IST10343H8
Vector VICTR76
Project tigm

Sequence tag IST10343H8HMF2
Sequence
ATAGGCCACCTACGCTGGTGCATCTTGTATTCCCAACATGGAGGTGGCGGAGACTCATGGCTCCCTAGCCATTTTGCCCG
CTGTCTCAGAAACAAAATGGAGGACGGCGGAGGGCTGACACCTGCGCGCATGCGTGCATGCGCACAAATGCACAGAGCAC
GGCCGTTTCTCTTATTTTAATGAACGGAGAAAAAATTTATATTGTCTTTACTTACCCATTTTTGTTCTCTTTTGAGACAG
GGTCTCCTTAGGTAGCCCTGGCGCTCACGGAACTCTCGATGTANATCAAGTTA
Sequence Type genomic DNA
Unitrap ID UNI451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 83383285..83383576 290
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031714 (Gab1) NM_021356 growth factor receptor bound protein 2-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:108088]


Sequence tag IST10343H8BBF1
Sequence
CTGTTACTGTGACAAAGTTACACCATANAGTACTCAACGCACACCATAGGGCCNCCGGGACTGTGAGTGGGACCTGATAA
TAGCAGAAACCGAGGCAGCCGGAACGCCACAGTCGGATCGAGGATTTCACTTGAGCCTGGGCGAGTTCCGGCTCCTTGCC
CGTGCTTTCTGACGTCACGAGGCGTTATGTGGTTTGCGGATGCTACAACGGGACTACATATCCCAGCGTGCAATGCGCTC
TGCCACTCGCGGANCGCGAGGCATCCTGGGGTTTGTAGTCTTCGAAGTGATAGGCTCAGTCTTTGAGTTGCAGGTTGTTT
ANAAGCATACACAGGTCTGGGACGTGTTCTTTGCTGTANGCTGTNGACCANAGGGTCAACACTTTGACGTCTTAATTCGT
TATGGAGTGTACACCCTANCTCCCTGCTGTGATATTATTTCCTTTTTGCANCTACTTCCCCTTANANCTAANANNNGCTN
AACTGANTCACAGCGTTTTGTAACAGAAAANANCTATTACNGCTNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 137149316..137149839 484
NO GENE  

 
Come back to gene ENSMUSG00000031714


For any suggestions or comments, please send an email to unitrap@crg.es