Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14796G8
Clone ID IST14796G8
Vector VICTR76
Project tigm

Sequence tag IST14796G8HMR1
Sequence
GANNNNANAATAGGGGCTGGAGAAATGGCCCAATGGGTAAGAACTCTTGCTGCTCTTACAGAGGACTTAGTTCAGTTCCC
AGTACCCATAGAGTAGTTCATAACCACCTATAACTCCAGTTATAGGAGATCAGATGCCCTTTTCTGGCTTCTGCACTACA
CATGGTGCACATACTTGTAGGTAAAACACTCATGCATGCTTTATAAAAAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI26976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 57416771..57416981 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031139 (Mcf2) NM_133197 mcf.2 transforming sequence Gene [Source:MGI (curated);Acc:Mcf2-001]


Sequence tag IST14796G8HMF1
Sequence
GATCATAAAGTTGGAAACAATCACTAATTCTTTTATCTCAAATGAGGAAATAAGGTTAGAATTCAACTTTTTTACGTGCT
ACAAGGTACAGAAATTACTGTATTTGGAATAACATGGAAAAGGAGGGAGGGTGCATCCATCTAGTCAGATGCTCAGTTTT
CATTGTGTCACTTGCAGAAACTCAGTTTCCATCAGTCCATTACATAGTAGGTGTTACACCTCATAAAGATGTATTTTATA
GTCATTCTAATTTAAGATGGGCTCTTCTGTAGCCTAAGCTAGTCTCAAACTCACTATGTAGCCCAGGCTAGTCTTAAATA
CATTATCTTCCTGCCTTTACTTCCCAAATGTTGGAATGATAGGTGCATGCCACCACAGGGGGCATTCNTNNCTCTTCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 57416987..57417384 392
 
EST/CDNA Est Name
  CN682606.1 - CN682628.1 - BB652139.1 - CN687622.1


Sequence tag IST14796G8BBF1
Sequence
GATCATAAAGTTGGAAACAATCACTAATTCTTTTATCTCAAATGAGGAAATAAGGTTAGAATTCAACTTTTTTACGTGCT
ACAAGGTACAGAAATTACTGTATTTGGAATAACATGGAAAAGGAGGGAGGGTGCATCCATCTAGTCAGATGCTCAGTTTT
CATTGTGTCACTTGCAGAAACTCAGTTTCCATCAGTCCATTACATAGTAGGTGTTACACCTCATAAAGATGTATTTTATA
GTCATTCTAATTTAAGATGGGCTCTTCTGTAGCCTAAGCTAGTCTCAAACTCACTATGTAGCCCAGGCTAGTCTTAAATA
CATTATCTTCCTGCCTTTACTTCCCAAATGTTGGAATGATAGGTGCATGCCACCNCAGGGGGCATTCTTCTCTCTTCTCT
CCTCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 57416987..57417392 404
 
EST/CDNA Est Name
  CN682606.1 - CN682628.1 - BB652139.1 - CN687622.1

 
Come back to gene CN682606.1 - CN682628.1 - BB652139.1 - CN687622.1


For any suggestions or comments, please send an email to unitrap@crg.es