Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10077G11
Clone ID IST10077G11
Vector VICTR75
Project tigm

Sequence tag IST10077G11HMF1
Sequence
CAACAACAAAATGCCTCTCTGGAGTTGGCAAAGCATATAACATCTTTCCCAAATACTTGAATTGAAAGAAATAATGGAAA
CTTATTGGGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93332131..93332224 94
NO GENE  


Sequence tag IST10077G11BBR1
Sequence
GTTGGATTGTTTTAATTCATTTAGTAAACATTTCTCAGACATGACCCAAGAAGTCACCAGTCTCCAGGAATGCAGCAATG
AATGGGTGGGCATTGTGTTCCCGGGCTTGTGGATATTCTGACCCGATGTGATCATGAACACTGTTCTGTTGGGGCCCTGT
CTCAGAACCCAGAGCATTGTCTTTGGAGAGTCTAGTCTTTCATGGATTGTGTTTTGTTTCCAAAGCCTCCGGCTTAAAGG
GAAGACGTAAGATTCTAGTTGTCTTTCATTGGTGTTATTTCCTCAAACACTGGATCTTAGTCTGGTTTTCTTCTATTATT
CCTTACTAAAAATAGCAACAAAACAGCCTTACACAAAGGCCACTGAATGTAGAAGGTAGGTCACGGACTCTGACAACAGA
AAGACCTGGGTTTGCACCTGAGCCAGGATGCCTCCTGGTAGCACAGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI29739

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93332221..93332671 451
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]

 
Come back to gene ENSMUSG00000029381


For any suggestions or comments, please send an email to unitrap@crg.es