Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15053H6
Clone ID IST15053H6
Vector VICTR80
Project tigm

Sequence tag IST15053H6BBF1
Sequence
GTATGCACTTGTGTGATCTCATATGTGCGATCTGGTGTGCATTGGAAGATCAGAGTACCACTTGCAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI16740

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71106467..71106539 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]

 
Come back to gene ENSMUSG00000003279


For any suggestions or comments, please send an email to unitrap@crg.es