Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14565C4
Clone ID IST14565C4
Vector VICTR74
Project tigm

Sequence tag IST14565C4HMR1
Sequence
AGACAATATATGAGACAGTGTGTCACTATAATTTTATTTATAGATACTGAAAGCTGAATGGAAATAATTTTTATGTAATT
GTCATGAATCAAGAGGTTGGTTGGTTGGCTGGTTGTTTTCCTCATTA
Sequence Type genomic DNA
Unitrap ID UNI32738

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75226201..75226327 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020196 (Cabin1) NM_172549 calcineurin binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1298375]


Sequence tag IST14565C4HMF1
Sequence
GTCTTTGACTTTATTAATGAAACAATTGAACAGCCACCCCAAATCTAAAACACTTACCATTAAAAGTATTGTTTTTTTTT
AAATTAAATTTACAACATAAAATATAAATCTATCTACAAAAGTGTGCCAACCCCTGAAGGAAATCATTCTAAATTTTATT
CCTAANCAAATTAATCAATCACATANAAGGAACTTTACCCANATGAGGTTCAATAGGCCACACTGATGACCTATAAAAAN
TCACGTCTTGAAAAGTTAANCGGCAAAGTCCACAAGTGCANAAACCTGACAGCGCCNGGTGAAGTCNTTCTACCTGCCTC
CTCCATGGAGGGTNTTGAGCAAAATGGCTGCANTCGGGGTAAGCCGCACCGGANCTTTAAAGTCNTTTANNACCTTCCCT
CGGCCTCAGTTTCCNCCCCTGGAAATGGTACTCACATCACACTCACCTCGCTGGGCTGCGGTGAAGGTNAACNAAAGGAC
NCACCGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14565C4BBF1
Sequence
GTCTTTGACTTTATTAATGAAACAATTGAACAGCCACCCCAAATCTAAAACACTTACCATTAAAAGTATTGTTTTTTTTT
AAATTAAATTTACAACATAAAATATAAATCTATCTACAAAAGTGTGCCAACCCCTGAAGGAAATCATTCTAAATTTTATT
CCTAAGCAAATTAATCAATCACATANAAGGAACTTTACCCANATGAGGTTCAATAGGCCACACTGATGACCTATAAAAAG
TCACGTCTTGAAAAGTTAAGCGGCAAAGTCCACAAGTGCAAAAACCTGACNNCGCCNGGTGAANTCGTTCTACCTGCCTC
CTCCATGGAGGGTGTTGAGCAAAATGGCTGCNNTCGGGGTAAGCCGCACCGGAACTTTAAAGTCGTTNAAAACCTTCCCT
CGGCCTCAGTTTCCACCCCTGGAAATGGTACTCACATCACACTCACCTCGCTGGGCTGCGGTGAANGTGAACNAAAGGAC
NCNCCGAANGGGATGGCTTCNANCTGNGGTNNCTGNGACCCACCCTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020196


For any suggestions or comments, please send an email to unitrap@crg.es