Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13047D7
Clone ID IST13047D7
Vector VICTR76
Project tigm

Sequence tag IST13047D7HMR1
Sequence
ANATNAGTGTTTTTTCCTGANTGTCTGTCTGTCTCTGTACATCATGTGTGTGCCTAGGGCTTCTGGGACTGGAGTTACAG
GTGGTTGTANAGCTGANTCGTCTCGCCAGCCCCTTATTATTTTTGTGTATGTATGGCGGTGCATTCAGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI6542

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114377399..114377548 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


Sequence tag IST13047D7HMF1
Sequence
ATATACGTGCCATAAAATCTCTAAAAATAAAACTTTTGAAAAAGTTCTTAAAAGAGGACGATGGGNANCTCCTGCAAAGA
GGGNNANCACATTATCACATCAACTTTCTAACAAGCCGATCCCTTCCGAACCCAGAGGCGGACAATTGAGTTTCGGACGT
GAAGGAAGCTGGCAATTCCCTAAAAACAATCTCCAATGTCCGGGTCGGCTTCCAGAACCNGCCGGTANGTANGTAGTACG
CTCAGCCTGCGGGCTTCACGCGCCTGTTCCCGCGCTCCGAGGGGGCGGCGGCCCANGACAGCAGCTATGCAGAACCGACA
CATGCGTGTTCCNNNNCGCCTGAGGGCCGGGGTCCTGATAACCCGAACTCCGGANCCCACGGGCCGTGGGGACCTCNCGA
TCACNNNNNCCACNCCCTGGGGANCNTCCNGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13047D7BBF1
Sequence
ATATACGTGCCATAAAATCTCTAAAAATAAAACTTTTGAAAAAGTTCTTAAAAGANGANGATGGGNNNCTCCTGCNNANA
GGGAAAACACATTATCACATCAACTTTCTAACAAGCCGATCCCTTCCGAACCCAGANGCGGACAATTGAGTTTCGGANGT
GAANGANNCTGGCAATTCCCTAAAAACAATCTCCAANGTNCGGGTCGGCTTCCAGAACCNGCCGGTNNGTNNGTANTACN
CTCAGCCTGCGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es