Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11101H4
Clone ID IST11101H4
Vector VICTR76
Project tigm

Sequence tag IST11101H4HMF1
Sequence
CATTTGTGTAATTTGAAAGTGAGGAATATGCAAGTGTTTTGTTGGCAAGCACGTTATCCATAAAAGCTCTTTTATAAGCT
TGCAGTATCCGGGTTTACAAGAAAGGAAAATCTTATTAGAGCAAATTCTGAGAGTTAGCTGATTGAGTCATGCTTTCCAA
TCTAATTGACCNACAACTTCCTCCAGTGAGAATTTCAGAGGGTTGGGATTTGGGGTGG
Sequence Type genomic DNA
Unitrap ID UNI32741

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 69322382..69322599 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069601 (Ank3) NM_170687 ankyrin 3, epithelial Gene [Source:MGI Symbol;Acc:MGI:88026]

 
Come back to gene ENSMUSG00000069601


For any suggestions or comments, please send an email to unitrap@crg.es