Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14979G8
Clone ID IST14979G8
Vector VICTR76
Project tigm

Sequence tag IST14979G8HMR1
Sequence
ACAGCATGTGAGCACTTTACCTAGGGCTGAGCTAGAAAAAGCTCCAGAGGGCAGCCTGGGCTCTCAGTTCTGATCTGACA
AGAGCCACAGAGTCTAGCTCAGGTGAAATAGCTTTCTCGTGTCTTAGTTCCTCTGTTATAATGTGGTGGATTGATTGATT
GATTGATTGATTGATTTTGGCTTCTGTTTTTAAAAAAATTAATTGTTTGGAGGTGGCTANCACATGTGGAGGTCAGAGGT
CC
Sequence Type genomic DNA
Unitrap ID UNI15257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52177193..52177433 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]


Sequence tag IST14979G8BBF1
Sequence
CTGTGACTTAACTGCGGGATGGAGACCCACACCCAGGTCTAGCTAAGCATGCCTCTGCCATCCTTTCAGGTACCGAAGGA
ACCTGGGGAAAGCGCAAAGCTACAACGACAGTACAACCTTTCCGGAATCCTAGGGGCTCAGGTCCAGCATGAGGACCGCA
TGGCCCCAGACAGCCCCTGTCCAAAGCCTCATTCTANAAACCAGAAATAAAGCGAATCAGCTGTGAGCTACTACAAGTGG
GGACTGGCACCTTACTCGAGCTGTCATACCCCCACACCTGTCAGAAAGGGAAGAAGCTACAGGCCCCACAGCTTTGGCCA
GAATCCCATCTACCCATATCACTCTCTAGCTTTAAGCCCAGAAACACCAGTTGGACAAGTTCCCCCAGGACTTGGGAAGT
TGTANAATGCTAAAGGAGCTGTTTCTCATCTCTCATGACTACTGCTGTANGTGAGTATGTACGATTACAGCTCTTATGAC
ATCTATGACTCGGCTAGGACAGGATAGCTTCTAGAAGTGAGTGAGCTGTCTAGGTNATCTNATGGCTGNTTNAANANTCC
NCGANNGANTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52176626..52177196 545
NO GENE  

 
Come back to gene ENSMUSG00000020402


For any suggestions or comments, please send an email to unitrap@crg.es