Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12680E7
Clone ID IST12680E7
Vector VICTR76
Project tigm

Sequence tag IST12680E7BBF1
Sequence
CTATGAGGGTGACAGACACGGCAAAACTAGCTAATTATAAGGAATCTTACCTCAGTGCTGTGCCTCTCTGAATGAGAAAG
TGCCTCATTCATTCA
Sequence Type genomic DNA
Unitrap ID UNI30611

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127985032..127985126 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001995 (AC073946.23-201) NM_001081337 Signal-induced proliferation-associated 1-like protein 2 (SIPA1-like protein 2) [Source:UniProtKB/Swiss-Prot;Acc:Q80TE4]

 
Come back to gene ENSMUSG00000001995


For any suggestions or comments, please send an email to unitrap@crg.es