Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11411B4
Clone ID IST11411B4
Vector VICTR76
Project tigm

Sequence tag IST11411B4BBF1
Sequence
NGCCACACAGAAGCCGCAGGTTAGGTTGCTGCTTCTCCACTGAGTGTGTGCCTAACTTGAAACCCTCCAAGCTTTTCCGA
GCTGCCCTAAGCCCTTATGTAAGGTGAATGACCTGTTTACTACCCATCTANGAGGAAAGCACACTCCTGATGGTGGACAA
TGTTATGCAGGGGAAATGTCCAGAGGTGATCGGGGATACTTTGNCATGGNCTGCAAAGTGTTCTACTGTGTGTGAGTGGG
TGTTGACTGTGTATTCAATGGGCGTGACTCGTATACAGCTGANNACCTCNATCTCATGAACATCTGTGTCTGNCNNTGGC
TGNATAAAAAGGAAGGCAAGGATGCTGCACATGGCATTACCTCNNGTGGCTTCCAGATGTTCCAGCACCCTCTATTTNAC
AGTGGTAGCTTACAGCTGATTNCGANGTNNGGCCNAAAATGANTGCCTTTGGCATCTTNNANTGGCTGTGGCTTCTGAAT
TCCTTCCCATTCAAATTCCNGTGTCTAGAAACNNTTGNTCTNGNAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11411B4HMF1
Sequence
GGCCACACAGAAGCCGCAGGTTAGGTTGCTGCTTCTCCACTGANTGTGTGCCTAACTTGAAACCCTCCAAGCTTTTCCGA
GCTGCCCTAAGCCCTTATGTAAGGTGAATGACCTGTTTACTACCCATCTANGAGGAAAGCACACTCCTGATGGTGGACAA
TGTTATGCAGGGGAAATGTCCAGAGGTGATCGGGGATACTTTGTCATGGGCTGCANAGTGTTCTACTGTGTGTGAGTGGG
TGTTA
Sequence Type genomic DNA
Unitrap ID UNI17948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55053893..55054136 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]

 
Come back to gene ENSMUSG00000060206


For any suggestions or comments, please send an email to unitrap@crg.es