Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13042F4
Clone ID IST13042F4
Vector VICTR76
Project tigm

Sequence tag IST13042F4HMR1
Sequence
GGGTGATGAGTCNCAGGTAAGGAGGTAAGAGAGACATACAGGCTCGTGTGATGGGCCCAGTGCAGGAAGCAAAGGAACCA
GGGCAGCCTTGTGTCC
Sequence Type genomic DNA
Unitrap ID UNI29935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148288152..148288246 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST13042F4BBF1
Sequence
NNNCNNANGACANANACANAANAGGCTGCANANNNANANTCNATGGGCATCCNNNCNNTTNNTGCGGCTCTNTGTCCACT
GAANTGNNNTGAGCTTCATTCCCACTTTACCCANACCATCNTGCCTGGCCCANCTGGGCNNANGTGNAANGGTANATAAN
AAAATAGGTTCTGANTCCTANANACACCTACTGTGGGATGACACAGCTCAAACTCTCCTCCATGCCAGGTANTACCGTGA
GGCTACACAGTATACCCCAGGCCTCCAGAACACTGACCGCTACGCANNNGGTCCAACCTCAATCCTANGCCTGGCCTCCC
TTCTCCTNNNATCCTTCANGGGCCCTANTGACCNTATCATTTGTGANACGCCCTCTNNNCATCCCCTCCTCTGGTCCTCA
TCTCTGACCCCTGTTCTTGTTTGTNNNCCCTCTNNNNTAANNACTCCTCNNTCCNCCTCATTTGACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es