Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G056F02
Clone ID G056F02
Vector U3CEO
Project ggtc

Sequence tag G056F02
Sequence
TCTACACGCAGAAACACAGTCCACAGGAGGCACCCCACGTGCAGTATGAGCGTCTGGGCGCAGATGTGACGCTGCCGTGT
GGGACAGCGAGCTGGGACGCAGCTGTGACATGGAGGGTAAACGGGACAGATCTGGCCCCTGACCTGCTCAACGGCTCTCA
GCTGATACTGCGAAGCTTAGAACTGGGCCACAGTGGCCTATACGCCTGTTTCCACCGTGACTCCTGGCACCTGCGCCACC
AAGTCCTTCTACATGGGGTTG
Sequence Type mRNA
Unitrap ID UNI12002

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41617874..41622078 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028444 (Cntfr) NM_016673 ciliary neurotrophic factor receptor Gene [Source:MGI (curated);Acc:Cntfr-002]

 
Come back to gene ENSMUSG00000028444


For any suggestions or comments, please send an email to unitrap@crg.es