Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14444H2
Clone ID IST14444H2
Vector VICTR74
Project tigm

Sequence tag IST14444H2HMR1
Sequence
TTAGCAATGTTAGATATTGACCTAATGTGCAAAACATTATGTANATTTTTTTAAAACTAAATTTAGTAAGGGTTACTGGA
CTTAATCCTATTCCAGGAN
Sequence Type genomic DNA
Unitrap ID UNI23118

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110016878..110016974 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032480 (Dhx30) NM_133347 DEAH (Asp-Glu-Ala-His) box polypeptide 30 Gene [Source:MGI Symbol;Acc:MGI:1920081]


Sequence tag IST14444H2BBF1
Sequence
CTAGGAGACTAGGAGGGCCTATATTCCTGTTCCTGACTGCTAGTCCCTTTCATTCACACTTGTGGGGATGTGGGCAGTAA
AGGGCTTGATCTTTCAAAACCACAATATGACCTCCTCTTCCCCAGGTATGCTGGAAATTTCAACCAATAAGATAAAACTT
TAATAAAAATCAATTACAACACCACTTACATAGAGAAGTTACATCCTATCAACACCATCAATGCAAATTAAAAGAAGAGT
GTAGTTTGGCGTCCTAATTTTAAAGAAGACCTGAGTGTTTTAGGGTTTGCTTGTTTGGGATTTGTTTTGTTNTGNTNNNG
TANTANGAATTATAGTCAAGGCCTTGTTCATGCTAAGCAATTGATTACCNCNAANCTATANNNNNNGCCCATAAACAATA
CTTTCTTGCTNGGGAATTTTAAGTTAATCTGCACTTANACAGACNTGNANNNNGNTTTAAATTTGGTTTTTNNAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14444H2HMF1
Sequence
CTAGGAGACTAGGAGGGCCTATATTCCTGTTCCTGACTGCTAGTCCCTTTCATTCACACTTGTGGGGATGTGGGCAGTAA
AGGGCTTGATCTTTCAAAACCACAATATGACCTCCTCTTCCCCAGGTATGCTGGAAATTTCAACCAATAAGATAAAACTT
TAATAAAAATCAATTACAACACCACTTACATANAGAANTTACATCCTATCAACACCATCAATGCAAATTAAAAGAANAGT
GTANTTTGGCGTCCTAATTTTAAAGAANACCNNANTGTTNNANGGTTTGCTTGTTTGGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110016972..110017271 278
 
EST/CDNA Est Name
  AA171096.1 - BY274609.1 - CJ151389.1 - BY249109.1 - BB846569.1 - BY280970.1 - BY005995.1 - BB839791.1 - BB840429.1 - BB844242.1 - BY268738.1 - BY245829.1 - BY251721.1 - BY289464.1 - CJ174907.1 - BY003622.1 - BY249394.1 - BY252308.1 - BY206854.1 - BY201786

 
Come back to gene AA171096.1 - BY274609.1 - CJ151389.1 - BY249109.1 - BB846569.1 - BY280970.1 - BY005995.1 - BB839791.1 - BB840429.1 - BB844242.1 - BY268738.1 - BY245829.1 - BY251721.1 - BY289464.1 - CJ174907.1 - BY003622.1 - BY249394.1 - BY252308.1 - BY206854.1 - BY201786


For any suggestions or comments, please send an email to unitrap@crg.es