Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15056G5
Clone ID IST15056G5
Vector VICTR80
Project tigm

Sequence tag IST15056G5HMR1
Sequence
GGAAGAGCAGTCNGTGCTCTTAACTGCTGANCNNCTCTCCAGCCCTCAAGACTCTTTTGGGTTTTTGAGACAGGGTTTCT
CTGTATAGCCCTGGATGTCCTGGAACCTACCTTGTAGACCAGGCTGGCCTTAAACTTAGAAATCCGCCTGCCTCTGCCTC
CTGAGTGCTGGAATTAAAGGCATGCGCCACCATGCTGGGCTTTCAAGAAAGACTCTTAATAGTTGTAAGGGAACCCACAG
GGACAAAGAGACCAAGTAACTTTGGATTCAGTGCTGAACTAGATGGCGTAGCCTGCACACCCAGAGCTACGGCTGTGTGT
GCGTGTGCGTGTCTGTGTGTGTGTGTTCTAAGCATGGTTTTCCTCATGGAGCATTAACTGGTGGTACACAGAACTGAGAT
AGCCNGGCTCTGCCTGGGCAGGAAGGGTTTAGAGTGCCACC
Sequence Type genomic DNA
Unitrap ID UNI15045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165685921..165686362 428
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


Sequence tag IST15056G5BBF1
Sequence
TTCCAAAGGTCCCGAGTTCAATTCTCAGCAACCACATTGTAGCTCACAACCATCTGTAATGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165686359..165686426 68
NO GENE  


Sequence tag IST15056G5HMF1
Sequence
TTCCAAAGGTCCCGAGTTCAATTCTCAGCAACCACATTGTAGCTCACAACCATCTGTAATGAGATCTGATGCCCTCTTCT
GGTGTGTCTGAAGACAGCTACAGTGTACTCAAATAAATAAATAAATCTTAAAAGAGAGTTGAGAGAGAGAGAGAGCCTTT
CTACACGGAAAAGACCATGAGTCACTGCTGTCACTCCCCCCGCCCCCCACCCCCGTANACAGGGGAAACCTCAAACCANT
TTCCCCAAAACTTGCTGTGTCCCGACCATGGCTTGCAAGAGCAAGCCCGTCTGGTAAAACCTCACAGGCCGGTTCGGTTC
ACCAAAGCCCCTGCATGCTCANGACTCGATTCCTGACCTGATTGAACCGCTTCTATGCCCCATCATCCCAGCCCACCCTT
CNCACTCTTCCANAGATGGANGTCTCTGAANGCNTGCTCCTCTCNNGGCACANGANNCNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165686359..165686813 429
 
EST/CDNA Est Name
  DV066041.1 - CO431128.1 - CB521606.1 - BG342229.1 - BY740349.1 - CO426691.1 - CN678630.1 - CN458361.1 - CN670238.1 - BQ557916.1 - CF537480.1 - CN682831.1 - CD546981.1 - CD542561.1 - CB246134.1 - BB859998.1 - CD561836.1 - BY207768.1 - AA178103.1 - CJ121989

 
Come back to gene DV066041.1 - CO431128.1 - CB521606.1 - BG342229.1 - BY740349.1 - CO426691.1 - CN678630.1 - CN458361.1 - CN670238.1 - BQ557916.1 - CF537480.1 - CN682831.1 - CD546981.1 - CD542561.1 - CB246134.1 - BB859998.1 - CD561836.1 - BY207768.1 - AA178103.1 - CJ121989


For any suggestions or comments, please send an email to unitrap@crg.es