Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G053F05
Clone ID G053F05
Vector U3CEO
Project ggtc

Sequence tag G053F05
Sequence
CCATCTTGACTCCCTGACCTTGGACTGGTCCTCGTCCGTGGTCGTTCCGCGCCGTCATGTCTGTCCTGACGCCACTGCTG
CTGAGGAGCCTGACCGGCTCGGCCCGGCGGCTCATGGTGCCGCGGGCTCAGGTCCACTCGAAGCCGGCGCGGGAGCAGCT
CGGGGTCCT
Sequence Type mRNA
Unitrap ID UNI10860

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7291890..7292058 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035885 (Cox8a) NM_007750 cytochrome c oxidase, subunit VIIIa Gene [Source:MGI Symbol;Acc:MGI:105959]

 
Come back to gene ENSMUSG00000035885


For any suggestions or comments, please send an email to unitrap@crg.es