Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14720D2
Clone ID IST14720D2
Vector VICTR76
Project tigm

Sequence tag IST14720D2HMR1
Sequence
NAACCTCANCCAATTTCCNAGCCCTGACTCAAGCTGGCTGCTTTTCCTCGT
Sequence Type genomic DNA
Unitrap ID UNI29535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165707668..165707717 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


Sequence tag IST14720D2HMF2
Sequence
CACCTTCACAGCCAGGTCTCCCTTTGGAATGAATTTGTGGTGAGGTCAGCACTACTGCCTGGGGGCAGGGAATGGACGCA
GAGGATCTGGACTCAAGGGGCATTGAGTTGGTTGCCCAGGCTGCCCTCCCTCAAATTTCCATTCAGTGCCTTGTGAGAAG
ACTCTGACCTGATTGGGCAAACTGTCCTTACAGGCTCCAGCAGGGAAGGGCCCCTAGCCTGAGTGGGATACCCTCTAGGG
GAGGAGGCCTGCGTCCCTATCAGAGCTTGTCAAAAGCTGCAGCTANCANATGGTGTGTGCACCTTGGTACAGTCGTCTAA
NTGACAGGGTTNGAANCTNNTNNGGTGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119684089..119684437 329
 
EST/CDNA Est Name
  CF580086.1 - BB760661.1 - BY559355.1 - BY571799.1 - BY483731.1 - BY571788.1 - AA003322.1 - AA108002.1 - AI181738.1 - BX518765.1 - BF658669.1 - AA125223.1 - AA197531.1 - BF658227.1 - AA833124.1 - AA671688.1 - AA537809.1 - BY482456.1 - AA049717.1 - W91400.1


Sequence tag IST14720D2BBF1
Sequence
ATAATAAACATCTCCCAGTCCCCACCTGCTAACAGTAATTATAATAGACTCAACAATAAATGGTAAAGCAGGGCAGAGCT
GCATCTCGGGAATTCTCTAGGGCGTGTGGATTAGCTCGGAAAGCCTGAATGATTAAAATACACTAATTAAAATTTTGTGT
TCCTTGGTAACTCGTCTGCCTGGGCCCCTGGTGTTGGCAAAATGGGAATTAACGTGACAAAAGCAACACAGAGGGTTTTT
GTTTTAAATAAAGAAAAAAGTGGAGAGAGAGAGGGAGAGAAAGAGAGAGGGAGAGGGAAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148234776..148235080 305
NO GENE  

 
Come back to gene CF580086.1 - BB760661.1 - BY559355.1 - BY571799.1 - BY483731.1 - BY571788.1 - AA003322.1 - AA108002.1 - AI181738.1 - BX518765.1 - BF658669.1 - AA125223.1 - AA197531.1 - BF658227.1 - AA833124.1 - AA671688.1 - AA537809.1 - BY482456.1 - AA049717.1 - W91400.1


For any suggestions or comments, please send an email to unitrap@crg.es