Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14947F5
Clone ID IST14947F5
Vector VICTR76
Project tigm

Sequence tag IST14947F5HMR1
Sequence
ACAGAGACAGAGAGACAGAGACAGAGACAGAGACAGAGAGAGACAGAGACAGACAGATAGATAGACAGACAGAGGCAGAG
AGAGATACACAGAAAGAGACACACAGAGAGAAACCCAAACCTATACTTTCTCTTGGCTCCTTGTTCATTTAGGAATCAAT
ACCCCACTGTCTGGAAGGCCCTAATATCCCTCACCTACAGCCCTTANCTAACTTCAGTGTGGTTTCCATCTCCTCCTATT
TCTGGTTTCTGTGACAGGAAAATTANAAGGAAACAACTCACCACCCAGGCTTGCAACTGTAGCTGTAAGTGCTGACGGTC
TCAGGGAGTGGCCTACAGTCCCTGGAACTGCCTATCANTCCCCAGCCCTTGGANAACTGTANCANATAGAACAGCCTCGG
TGGTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI32752

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42998688..42999095 396
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032015 (Pou2f3) NM_011139 POU domain, class 2, transcription factor 3 Gene [Source:MGI Symbol;Acc:MGI:102565]


Sequence tag IST14947F5HMF1
Sequence
TGTCTCTCTGGTGTTTTTCTGAGACAGGGTTTCTCTGTGTAACCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTG
GCCTCGAACTCACAGAGATCATCCTGCTTCTTCTGCCTCTTCAGTGCTGGGACTAAGGTGTGCACCATCGCCAAACAGTG
GGTTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42999093..42999257 165
NO GENE  


Sequence tag IST14947F5BBF1
Sequence
TGTCTCTCTGGTGTTTTTCTGAGACAGGGTTTCTCTGTGTAACCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTG
GCCTCGAACTCACAGAGATCATCCTGCTTCTTCTGCCTCTTCAGTGCTGGGACTAAGGTGTGCACCATCGCCAAACAGTG
GGTTTGGCTTCTTAGGGATGAAAAACAAAGGCGATTGGTACTCTCATTAATGGAGGCTCTCATTTTCCAAGGATGGTTTT
GAACGTTCACAAAAGCACAGATAAGAACGTCAGAATCCCATTACCANAATCTGTCCTGGTTTTGTANTAACTTGGGGTGG
TANTGGCACNNCCACANANGTGANGNACCGANCTGGGACANACNNANGCTCANACNNANNCNNCNNCANTTCTTCTCCNT
GCNNTANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032015


For any suggestions or comments, please send an email to unitrap@crg.es