Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13738A1
Clone ID IST13738A1
Vector VICTR74
Project tigm

Sequence tag IST13738A1BBF1
Sequence
TTGTGAGGCAGAGGCAAGAACAAAACCTTGTCTGCAATAAGCGAACACACACAATAAAGAAACCGTTTANTCAAACAGGT
AAAGGAGAACTAGAAATTAAAATCAACAAGGTGGGGTGCATTTCTTTGGGCATGGCTGGTTTTGTTTTGAGACTGTGCCT
CTAGCTGGCCTGGAACTCGCTGTTTACACCAGGCTGGGCTTGAACTCAGGGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI31072

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27772997..27773214 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052146 (Rps10) NM_025963 ribosomal protein S10 Gene [Source:MGI (curated);Acc:Rps10-003]


Sequence tag IST13738A1HMF1
Sequence
TTGNGAGGCAAANGCAAGAACAAAACCTTGTCTGCAATAAGCGAACACACACAATAAAGAAACCGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000052146


For any suggestions or comments, please send an email to unitrap@crg.es