Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10077A1
Clone ID IST10077A1
Vector VICTR75
Project tigm

Sequence tag IST10077A1BBF2
Sequence
CAGGCCAGCCTAGGGTACAGAGAGAACTGAAGGCCAGCCTAGGGTACAGAGAGAACTGCAGGCCAGCCTAGGGTACAGAG
AGAACTGCAGGCCAGCCTAGGGTACAGAGAGAATTGCAGGCCAGCCTAGGGTACAGAGAGAACTGCAGGCCAGCCTAGGG
TACAGAGAGAACTGAAGGCCAGCCTAGGGTACAGAGAGAACTGCAGGCCAGCCTAGGATACATGGTAAGATCCTGTCTTT
AAAAGAAAATCACAAAAACCAAAACCAAACCAAACCAAACAAACAGTAAAACAAAATAGTATACCACACATCTTAAAACA
TGAGAGTAAAATGGACACTTGTACACTACCTGCCATACCGCCTGCTTCATCTGTAGTCCATCTTTAGTATGGATTCCAGA
GATAAATGACCTCTGGTCTGGGCCGCTGCATGTTTCACAGGACTCTGAAAAATGTGTAGAGATCACCCTGGGCTTGTCAG
CTGGTGTAGACTGGGCAGGCTGGGTGGCCTTTGAAGAAGATGTGACTGGAAAGGAGAAATGACAAGCCTGCTTAGAT
Sequence Type genomic DNA
Unitrap ID UNI32757

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12402338..12402892 547
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052374 (Actn2) NM_033268 actinin alpha 2 Gene [Source:MGI (curated);Acc:Actn2-001]

 
Come back to gene ENSMUSG00000052374


For any suggestions or comments, please send an email to unitrap@crg.es