Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14929F11
Clone ID IST14929F11
Vector VICTR76
Project tigm

Sequence tag IST14929F11HMR1
Sequence
CTCNCAGTCNTCTTCANACTTGGGGACTGCCCTTTACTATCACTTCAGACCTGAGGCCATCATTTTCCATCACAGCCTTT
GGATTTAAAAAGCCCAAGGTCTTTTGAACAGGAATTGGGTTTCTTTGCTTTAAATAATCCCAGGAAAGGGTTATGTAGTT
TCCACCTGTGTTTTCNGGTGTCATTTCTCTCAGGACAGGCTTACTTAGGCTATTATGTCTCTTAANCCTTTTATACTTAC
ATANAAATTGCTGAAGACATGGGCATTCTCTTCTGCAAACAACCTCNNTGCAGTTATCACACCAGGGGTTNAATATCTGC
TGCTTAAACACTANGTCTTACTCATATTGACTGATTATCCCNNCAGTGTTCTTANTTGTGTGGATGTGGATGCCCCGTGT
GTGGATGTGNATGTTCTAGGTTN
Sequence Type genomic DNA
Unitrap ID UNI1163

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124480307..124480728 394
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025316 (Banp) NM_016812 BTG3 associated nuclear protein Gene [Source:MGI Symbol;Acc:MGI:1889023]


Sequence tag IST14929F11BBF1
Sequence
GTGTGCACTTACTTGGTTCCTCTTTAGGACTGAATTAGAATGGCAAACCCGAGCCCTGTCCACTCCAGGGAGCATGGGTG
GACAGGGCTCCCCTGCTGAGGGAATACATAGCATAATAGATGCATAAACTGTAGGCTCAGTCTCATGGCGGGGATGGTGT
GGCGCGGTGCCCTGTGACGGTCANAGAACTTCAATAGTCANTTCTCTACCTCTGCGTGGAAGCTGGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 54850520..54850751 228
NO GENE  

 
Come back to gene ENSMUSG00000025316


For any suggestions or comments, please send an email to unitrap@crg.es