Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15068H10
Clone ID IST15068H10
Vector VICTR80
Project tigm

Sequence tag IST15068H10HMR1
Sequence
NNTNNGAACATGTTCNAAGAGGGCTAATCCTGAGTCCACAGGTAGTAACAGGCCTAGCTATGAGATCTGTTGGTTTTTCA
GGTGCAATAAATGCCGACTGAATGTAACCTGACACCAGGTGAGCTGAGT
Sequence Type genomic DNA
Unitrap ID UNI16767

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 79927552..79927675 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036461 (Elf1) NM_007920 E74-like factor 1 Gene [Source:MGI Symbol;Acc:MGI:107180]


Sequence tag IST15068H10BBF1
Sequence
CTGAAAACATGAGAATTTAAAACTAAGAATTTAAAGCCATGATAGTCATAAATTTAGTCATGAAAAAATTAATTAATTTT
TCAAAAAGGCTGTTATCATCAAAATATTAGCTTATGCTTTATTATGTGAATTAACTGTCTACAGAAACTTTCTTCTCTCC
AGTACCCAAAACCTGAACTCTGACAAATACCATCTACCCAGAAAACATAAACATGCTATAACACCCTTATCAGTAAAACC
TGTTCAGGCAACTAAACATTTTTCTCTGCAACAAACAAGAATTAACCTGCAAGAAATCTGTTCCATTTCTGTGGCTGCTT
ACTCCCCTGGTTAATATTTTCGTTTTGGGAAAACCAAGCTCTCCCACCATGGTTTGATTCTCATCACTTGGGCTTTGGCA
CTGANTGCATGANGAAAGGCAGGGAGGGATGTGTGCAACCTCCANGCCCACGCTGTTCCNCAATANTCCCAGCATTTGCA
AGTTANANACGGANATNGNATGCTTACTGANATCCTGNCTTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 79927030..79927552 499
NO GENE  


Sequence tag IST15068H10HMF1
Sequence
CTGAAAACATGANAATTTAAAACTAANAATTTAAAGCCATGATAGTCATAAATTTAGTCATGAAAAAATTAATTAATTTT
TCAAAAAGGCTGTTATCATCAAAATATTAGCTTATGCTTTATTATGTGAATTAACTGTCTACAGAAACTTTCTTCTCTCC
AGTACCCAAAACCTGAACTCTGACAAATACCATCTACCCAGAAAACATAAACATGCTATAACACCCTTATCAGTAAAACC
TGTTCAGGCAACTAAACATTTTTCTCTGCAACAAACAAGAATTAACCTGCAAGAAATCTGTTCCATTTCTGTGGCTGCTT
ACTCCCCTGGTTAATATTTTCGTTTTGGGAAAACCAAGCTCTCCCACCATGGTTTGATTCTCATCACTTGGGCTTTGGCA
CTGAGTGCATGAGGAAAGGCAGGGANGGATGTGTGCAACCTCNNNNCCCACGCTGTTCCACAATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 79927089..79927552 450
NO GENE  

 
Come back to gene ENSMUSG00000036461


For any suggestions or comments, please send an email to unitrap@crg.es