Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13730D11
Clone ID IST13730D11
Vector VICTR74
Project tigm

Sequence tag IST13730D11BBF1
Sequence
GTGAGGATAAGGCCACTGGAAGTTCTGGGTTCCCATTTTCAACGCCATTAAGATTTTTCTGGGGATGAAAGGTCTGGATT
GGTGCTCAATGCCCACACCCTCACCTATGGTTATTCTTGTACTGTGGTCATGTGTCCTCACAGCTTACTGTGAGTTCCTT
AAGGACANAGGCTGCNNAATTTCTAGAGACTCGTTTGGGTANGAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI16931

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133727871..133728079 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030720 (Cln3) NM_009907 ceroid lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease) Gene [Source:MGI (curated);Acc:Cln3-002]

 
Come back to gene ENSMUSG00000030720


For any suggestions or comments, please send an email to unitrap@crg.es