Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14370H12
Clone ID IST14370H12
Vector VICTR74
Project tigm

Sequence tag IST14370H12BBF2
Sequence
ATCNNCATGGTGGGAAACATGGAANAAGGCAGGCANACATGGTACANANGAGCTAANAACTCTCCAACTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14370H12HMR1
Sequence
NCTGATAATGCACTAAACCTCTGAAGTTGTAAGACAGCCCCAATTAAATCCTTTTCCTTGTAAGAGTTC
Sequence Type genomic DNA
Unitrap ID UNI9316

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30902944..30903010 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037643 (Prkci) NP_032883 protein kinase C, iota Gene [Source:MGI Symbol;Acc:MGI:99260]


Sequence tag IST14370H12HMF1
Sequence
AAGTCAGCCNGGGGTACATAAGGAGACTCTCTCGATAATACTCAAACAAACAAGGACTACTCATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92514160..92514226 65
NO GENE  

 
Come back to gene ENSMUSG00000037643


For any suggestions or comments, please send an email to unitrap@crg.es