Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CF0308
Clone ID CF0308
Vector pGT0lxr
Project sanger

Sequence tag CF0308
Sequence
AGCAGAGAGGATGGCTGAATGGATACAGCAGAACAAGTATTTTATCCATAGTTTTACGAGATAGCCTTCATCAACCGCAG
TATGTAGAGAAACTAGAAGAGATTCTTCGTTTTGTCATAAAAGAAAAAGCTCTGACCTTGCGAGATCTTGATAATATATG
GGCAGCACAGGCAGGGAAACATGAAGCCATTGTAAAGAATGTACATGATCTACTGGCCAAATTGGCATGGGATTTTTCTC
CTGAACAACTTGATCATCTTTTTGATTGCTTTAAGGCCAGTTGGACAAATGCAAGTAAAAAGCAACGTGAAAAGCTCCTT
GAGCTGATTCGTCGTCTTGCAGAAGATGATAAAGATGGTGTGATGGCACATAAAGTATTGAACCTTCTGTGGAATCTAGC
TCACAGTGATGATGTGCCTGTAGATATCATGGATTTGGCTCTCAGTGCTCACATCAAAATACTAGATTATAGTTGCTCCC
AG
Sequence Type mRNA
Unitrap ID UNI1775

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12687202..12690892 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031010 (Usp9x) NM_009481 ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI (curated);Acc:Usp9x-001]

 
Come back to gene ENSMUSG00000031010


For any suggestions or comments, please send an email to unitrap@crg.es