Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14418E5
Clone ID IST14418E5
Vector VICTR74
Project tigm

Sequence tag IST14418E5BBF1
Sequence
CCCTCTCTAGTGTATCTGAAGACAGCTACAGTGTACTTATCTATAGTAATAAATAAATCTTTGGGCCAGAGTGAGCAAGG
ACTGAACAAGTGGGGCCGACCAGAGTGAGCAGGGTTGACCANAGTGAGCAGAGGTCCAAAAATTCAATTCCCAACAACTA
CATGAAGGCTCACAACCATCTGTACAGCTATAGTGTTCTAATATACATAAAAATAAATAAATAAATAAATAAACAAACAA
ACAAATCTTTTAAAAGTATAAAAATAAAAGTTATCTTGCAAACCATTTCTAAGGGTTCATTAGCCTTCAGAAATCCTTAA
AGTCCTGTTATCACAGGTTAAGATAGAAAGGTATTAAAAAGCAAGTACATTTNNTTTTGGGGGGAGGTGTNNGGGGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96099045..96099441 387
 
EST/CDNA Est Name
  BB873204.1


Sequence tag IST14418E5HMR1
Sequence
GGTTTTTNNTGTTTTTTTCTGAGGATACTACAGTTTAGGCTGCCTCAAGCTGGCTGCCTTTATAGATGGGTAAAGCTGCT
CCTCGCTCACCTCAGCATCCTAAGCCCTGAACTGTGGGCGCACACCACTAAGCCTCTCTTTTAAAATATTGGCN
Sequence Type genomic DNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114312304..114312456 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


Sequence tag IST14418E5HMF2
Sequence
CCCNCTCNANTGNANCNGANNACNGCTACNGTGTACTTATCTANNNTAATAAATAAATCTTTGGGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es