Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P008B09
Clone ID P008B09
Vector FlipROSAbetageo
Project ggtc

Sequence tag P008B09
Sequence
ATTCTCCTTCCTAACCCTCGTCCCCAAGGAACTCGGTGTGTGTGTGCGTGTGCGCAGGGCTCCCGCTGGGGCGGGTGCCC
AGGGAGTGCCCGGACTCGCGGGGGAGCGCCCACGGGAACGAGATTGCTTCTATTTTCCTGTATGAAGCGGTTGGCACCAC
TTAAGTGACCGAATGAG
Sequence Type mRNA
Unitrap ID UNI4551

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108494808..108494984 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es