Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P008F09
Clone ID P008F09
Vector FlipROSAbetageo
Project ggtc

Sequence tag P008F09
Sequence
ATGTGGCTCGCCGCCGTGGAGGTCCCAGGTGAGCGGACGGTTGGAGAGTTTGGGTTTCCTCTGCGCCGAGGCGCCAGTTT
GGCGGATGCGGACACCAGTCCTAACAGGAGGGAACCGGCTGGAGAGCCGGGATCGGAGGAGCCTCTGCCCGAGGGAGTTC
CCGCTATGGAACCCTGCTTGAGGTTCTGAACTGCTTTACC
Sequence Type mRNA
Unitrap ID UNI12015

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 126545399..126545598 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031976 (AK122209) NM_001029876 URB2 ribosome biogenesis 2 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2681124]

 
Come back to gene ENSMUSG00000031976


For any suggestions or comments, please send an email to unitrap@crg.es