Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14362D4
Clone ID IST14362D4
Vector VICTR74
Project tigm

Sequence tag IST14362D4HMR1
Sequence
CATCCTGTCCCTCTTANGAATACATATTANAGAATATGCTCCAAGCCTTTGAACTTATTTGTTATCACCTCTGGTTATCC
TACTGTANAATGTTTCTTANGAATTGTGACAGTTTCATGTGTTGGAAAGGAGCAGGTTAATTTGGCA
Sequence Type genomic DNA
Unitrap ID UNI5022

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 82665880..82666026 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078669 (AC113019.13) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3TA34]


Sequence tag IST14362D4HMF1
Sequence
GATGGTTTACAAACACTGAAGCAAAATAACAATTCGAATATTAAAATTAATAGAATGGATAAGTAGTGAATGAGACTTAG
AAGAGAGCTTTTTTAAAAAGTCAATAAATGTGTAAGAAGACTGAGACTATTTTAAGTTCTGAACAAAACAGAAAAAGCAA
TCGTCTGAAAGCACTGAGGGAGTAAAAGCTGAGAGCTGANAACGTTGCTGANATTCACTTTTGTTCTTTTCACTTTGCAG
GTCAAGGCNGCCCAGNNCACATGGTGGAGCAGCAAGAGCTCATGCANAAAGCTGCNGTCTTANAAAGCTATGTGTGAATC
CAAGTCCTCGCTNCNCTANATCGGACTGGTACTGATGAGAGTCCNNNGCTTCTCGCACAAAGCNNANGCACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000078669


For any suggestions or comments, please send an email to unitrap@crg.es