Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10806B2
Clone ID IST10806B2
Vector VICTR76
Project tigm

Sequence tag IST10806B2HMF1
Sequence
GTACATGATTATACAAACCAGCCTTAGGTCCGGAGCAGCCATCCACGCTTGTGGCCCACATCCCCTGGCCCTGTCCCAGC
GGCAATAACCAGGTAANGAACCCAAAATGACCTCACAGAGCAACAACTAAAGCACACCAGGCCCTTAGGATATGGCGGCA
CTGCGCTAACAGACTTCACCACAGGCATCCTAAGGTTCCTGACAGGCCTGGANAGCCTGANGGGACAGAACCAAGACTCC
AACGGGATACCNCANATNCNNNTCCCTATATTTAAACATGGCATTGCTNATCTGCNTCTGGA
Sequence Type genomic DNA
Unitrap ID UNI31160

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28624634..28624934 279
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074243 (AC164532.4-202)  

 
Come back to gene ENSMUSG00000074243


For any suggestions or comments, please send an email to unitrap@crg.es