Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P016G03
Clone ID P016G03
Vector FlipROSAbetageo
Project ggtc

Sequence tag P016G03
Sequence
CCGCCAAGCGCCCAGCCCTCTGCGCCCTGAGGCTCGGCCCCCGGGGTGGGAGCCGCGCCGAAAGCTGGAAACATTCCTGG
CAG
Sequence Type mRNA
Unitrap ID UNI8198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59450171..59450253 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es