Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11988A3
Clone ID IST11988A3
Vector VICTR76
Project tigm

Sequence tag IST11988A3BBF1
Sequence
CCCATACATTAATTTTTCATTCCCGAGTTCCAGTACCACGCTAGTCTAGAGTATGGATCT
Sequence Type genomic DNA
Unitrap ID UNI18165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 298454..298512 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 59534346..59534404 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 9241512..9241570 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 11640527..11640585 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 116862007..116862065 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 88975307..88975365 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21158058..21158116 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 36317092..36317150 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 114737475..114737533 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 69976363..69976421 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 10311181..10311239 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 61207343..61207401 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 113111670..113111728 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 23552626..23552684 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 73385781..73385839 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 3672405..3672463 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 80182363..80182421 59
NO GENE  


Sequence tag IST11988A3HMF2
Sequence
CTTCTTCTTTTTTCTTTTTCTTTTTTCTCCTACTGGGATTCTTCTCTAAGTGAAACGTTACATGTTTGTCTCTGGCATCT
AAAATTTGACCTTTTCACCTGTTCTGTTCTGATCACAATAGCAAAACTCANACTTTTCCCTGTCTTCCAATCTACACCCC
TCATGTTAGCAGCAGAGAACGGCCCCCTGCCTGCTCANCTTCACTCTTCCCTCTTCCCTGACACCGCCTAACAACGTGGC
CTTTCTGTGCTCTCTTTATCAAAAGCTGAAAAAAATAAAATAAAATAAAGGTTA
Sequence Type genomic DNA
Unitrap ID UNI12785

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31937614..31937906 287
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029136 (Rbks) NM_153196 ribokinase Gene [Source:MGI (curated);Acc:Rbks-001]

 
Come back to gene ENSMUSG00000029136


For any suggestions or comments, please send an email to unitrap@crg.es