Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11909A12
Clone ID IST11909A12
Vector VICTR76
Project tigm

Sequence tag IST11909A12BBF1
Sequence
GTGCCCAGCAGCCCCAGCCTTATGTGATGGTGTTATCCAGTTCAAACGGGTTTTCCTCTCAGGTAGCCGTCAAACANAAT
GAACTGCTAGAGCCCAACTCTTTTTAATACACCAAAGGAATTATGGGTGGGTATTTTTTTAATTGAACTCATTTTTCGGT
TGTCTGACCNTAACATGATTTTTTTCTAANATGAAATCCACANAANTTCTTAACTGTTAAAAAGTTACTTTTGACTTTGC
TAGATAAN
Sequence Type genomic DNA
Unitrap ID UNI9170

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 79980471..79980717 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036461 (Elf1) NM_007920 E74-like factor 1 Gene [Source:MGI Symbol;Acc:MGI:107180]


Sequence tag IST11909A12HMF1
Sequence
NGCCCANCAGCCCCAGCCTTATGTGATGGTGTTATCCNNTTCAAACGGGTTTTCCTCTCAGGTAGCCGTCNAACANAATG
AACTGCTANAGCCCAACTCTTTTTAATACACCAAAGGAATTATGGGTGGGTATTTTTTTAATTGAACTNNTTTTTCGGTT
GTCTGACCNTAACATGATTTTTTTCTAAGATGAAATCCACANAANTTCTTAACTGTTAAAAANTTACTTTNGACNTTGCT
ANATNAGGAGGCGAACCCNAGTGTGTGTCTCCTCTGAATGTCNCANNACTNAGTTGTGAANGANCANGAGGTTTANACGA
TGAAGAAATTCTTGACTGTTTTTCANTTGCTATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000036461


For any suggestions or comments, please send an email to unitrap@crg.es