Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14956G3
Clone ID IST14956G3
Vector VICTR76
Project tigm

Sequence tag IST14956G3HMR1
Sequence
GGACCTCTCGCCTCATAGTTTTCCCTGTCATCAAACACTCCCTTACTACAGTACATTTTTGTTTGTTTTACTTCTGAGAC
CGCGTCCCGTTCTGCAGATGAGGCTGTTCTTGAGGCCACCCTCGCAGCCAGGTCAGGCTTGCACTACAAGCCTCCTGAAC
ACCGAGACTCTAGAGTGCCCCATCACCTTGGCTTACACNTCCTTTTGGTCTTGTTTGTCTGTTTGTTTCTGTGTTTGTTT
TTAAGACAGGTCCCTCTATGTAGCTGTGGTTGTCCNGGANCTCNGTGTN
Sequence Type genomic DNA
Unitrap ID UNI4277

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74819567..74819854 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024069 (Slc30a6) NM_144798 solute carrier family 30 (zinc transporter), member 6 Gene [Source:MGI Symbol;Acc:MGI:2386741]


Sequence tag IST14956G3BBF1
Sequence
GTCCTAGATTCAATTTCCATACCTACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAAAATACCN
NGTGGATTTTGAGGTTAAATAAAANAAGGANAAAAGAAGAAAAAACCAACTNGATGCCATTAANCATANAGGAAAATCAN
AGCATCCATGAAAAANAATGTAANNATTGACTTATTTTANCTTTGTGTGCATGANTGTCTTGCCTGCNTGTACGTCNGTG
CGGCNNGTGCNTGCGNNGGCCCGGGGAGGCCGGCNNAGAGGTGAGCCACNNTGTGGACGCTGGNANNGGGGTCCANGTCT
TCTGGANGGGCANCCANTGCTCTTGGCNNCTGNANCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14956G3HMF1
Sequence
GTCCTAGATTCAATTTCCATACCTACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAAAATACCC
NNTGGATTTTGAGGTTAAATAAAAAAAGGANAAAAGAANAAAAAACCAACTNGATGCCATTAANCATAAAGGAAAATCAN
AGCATCCATGAAAAAAAATGTAAAGATTGACTTATTTTANCTTTGTGTGCATGANTGTCTTGCCTGCNTGTNCNTCNGTG
CGGCNTGTGCNTGCCANGGCCCGGGGAGGCCGGCNNANAGGTGANCCNCCNTGTGGACNCTGGGAATGGGGTCCAGGTCT
TCTGGANNGGCNNCCAGTGCTCTTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000024069


For any suggestions or comments, please send an email to unitrap@crg.es