Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P017E06
Clone ID P017E06
Vector FlipROSAbetageo
Project ggtc

Sequence tag P017E06
Sequence
AAGGGGNNNAAAATTTCCCAACTCCAGGAATTGGTGGCGGAGAGGGGGCAAGTCACCAGGGCTCTTCCCGGCGCCCCAAT
GCGCGCACCATGTCGAGGCGCAAGCAGGCGAAGCCCCAGCACATCAACTGGGAGGAGGGCCAGGGCGAGCAGCCTCAGCA
GCTACCGAGCCCCGACCTCGCCGAGGCGCTGGCGGCGGAGGAACCCG
Sequence Type mRNA
Unitrap ID UNI1046

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168592412..168592618 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es