Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13353B1
Clone ID IST13353B1
Vector VICTR74
Project tigm

Sequence tag IST13353B1BBF1
Sequence
GTCCGAAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCACCCGTAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI2643 UNI10046 UNI18332 UNI21079 UNI32414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5978765..5978824 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 36872155..36872214 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 34697254..34697313 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22216723..22216782 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 35436624..35436683 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037646 (Vps13b) vacuolar protein sorting 13B (yeast) Gene [Source:MGI Symbol;Acc:MGI:1916380]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9747088..9747147 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3821094..3821153 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020661 (Dnmt3a) NM_153743 DNA methyltransferase 3A Gene [Source:MGI Symbol;Acc:MGI:1261827]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5583470..5583529 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083108 (AL669935.7)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14581096..14581155 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 7739800..7739859 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 8568376..8568435 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 23534158..23534217 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031533 (Mrps31) NM_020560 mitochondrial ribosomal protein S31 Gene [Source:MGI Symbol;Acc:MGI:1913153]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 5002057..5002116 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032827 (Ppp1r9a) NM_181595 protein phosphatase 1, regulatory (inhibitor) subunit 9A Gene [Source:MGI Symbol;Acc:MGI:2442401]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 17318456..17318515 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30349667..30349726 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34737466..34737525 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 23237124..23237183 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 11411099..11411158 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 16230143..16230202 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4748230..4748289 60
NO GENE  

 
Come back to gene ENSMUSG00000032827


For any suggestions or comments, please send an email to unitrap@crg.es