Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11521C2
Clone ID IST11521C2
Vector VICTR76
Project tigm

Sequence tag IST11521C2HMF2
Sequence
ACAGACAGATGCACACAGGAGAGGTTGTGTANAATCTGAATGTAATGTCAAATCCANCATCAGACTTTTTATACAGAAGA
CAATAAGGAAGTTGGGTGACATTCCTGCACGGTAAAAAGAGGTTACTGGATTCTTACATAAAACAGAGGAATGCAAACAC
AGAAGGTCTAACAGGAACCACCTGGGATANAATTCATTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI32403

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103057605..103057808 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032549 (Rab6b) NM_173781 RAB6B, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:107283]


Sequence tag IST11521C2BBF1
Sequence
ACAGACAGATGCACACAGGAGAGGTTGTGTANAATCTGAATGTAATGTCAAATCCANCATCAGACTTTTTATACAGAAGA
CAATAAGGAAGTTGGGTGACATTCCTGCACGGTAAAAAGAGGTTACTGGATTCTTACATAAAACAGAGGAATGCAAACAC
AGAAGGTCTAACNNGAACCACCTGGGATAGAATTCATTGTTAACAACTGGGATCAACNNGGGCTCCACCTAANATTCANT
TANTNTTANAAGCCCAGGGTCAAGGGCTTCNTGCCCTTGCCATANTTCCTATTTTANTCTATTGTATANTCCACCTTCCC
CTTNNCCATTGTAAATACGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032549


For any suggestions or comments, please send an email to unitrap@crg.es