Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14834A7
Clone ID IST14834A7
Vector VICTR76
Project tigm

Sequence tag IST14834A7HMF2
Sequence
ATACAATAGGCACACCATAAGGAAAGCCAACTGAGCATTTTGTAGCTGAACGTAAAATTACACTAATACCGGTGCTAAAG
CGTTCTACATTTCATAGGTTCAAATAATATGTAAGGAACCCTTGGAAAAAGTATAAAAACTGAAATACAGTAACAAATCA
CTTGCCAAATTGTTGAAAGAAACAACTCACACTGTTTAAGTTCAGCATGGATTTTTTTTTCCATTAAAACTTATATAAAA
TGAAATGTTGATATATTAAGGTATATGAACCAATAATCAANAGGAATGTTTAATGTATGTAAACAACCTGTCACTTCCCG
AAACTCCNTTNNCTCTTTTCCNATCAACTGCTGTGANCCACAGCATATACATAACTNCNTATAGANANANAGTCTTGATT
GNGACCCCNNCNNGCCNGNAACTTGACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14834A7BBF1
Sequence
CCAGCAACCACATGGTGGCTCACAAACACCTGTAATGGGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI30296 UNI32780 UNI32781

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 25307966..25308009 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 36596128..36596171 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 41101430..41101473 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4533911..4533954 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 20816728..20816771 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 25296237..25296280 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035910 (Dcdc2a) NM_177577 doublecortin domain containing 2a Gene [Source:MGI (curated);Acc:Dcdc2a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 70706270..70706313 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5020640..5020683 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 43691637..43691680 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 31288723..31288766 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 7444689..7444732 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4718431..4718474 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 30196565..30196608 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 66097914..66097957 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57260065..57260108 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 28538856..28538899 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027692 (AC121268.7)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 5827807..5827850 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71910967..71911010 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049044 (Rapgef4) NM_019688 Rap guanine nucleotide exchange factor (GEF) 4 Gene [Source:MGI (curated);Acc:Rapgef4-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 13078014..13078057 42
NO GENE  

 
Come back to gene ENSMUSG00000049044


For any suggestions or comments, please send an email to unitrap@crg.es