Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P017H08
Clone ID P017H08
Vector FlipROSAbetageo
Project ggtc

Sequence tag P017H08
Sequence
CAAGAGAAAGTACGAGTTCTTCAGAAGGAAGCTCAAGAAGCAGACTGACATTCCAAACAAATTTGAAATGAAGCTTCGCC
GCGCAAACATTCTGGAGGATTCTTACCGGAGGATTATGGGTGTGAAGAGAGCTGACTTGCTCAAGGCCAGACTCTGCACC
ACCTCCCCAGCATTGGAGCCCGAGTTTTGCGGCATGAGCCGGCGCACCTACAGTGACTTGCGCCGACCGTCCTCCTGTCC
CTGCCGTCTTGGCGCGCGGACTACTGTGGACG
Sequence Type mRNA
Unitrap ID UNI1832

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72580422..72582929 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]

 
Come back to gene ENSMUSG00000032216


For any suggestions or comments, please send an email to unitrap@crg.es