Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12060H8
Clone ID IST12060H8
Vector VICTR76
Project tigm

Sequence tag IST12060H8BBF1
Sequence
AAACATTTGCTTAATACAGATAACTTCGTACTGAAGTCAAGGACATGTATTTCCCGTGTTACGTATTTCTGCCCTAGAGA
CAAATACTAGAAATCGAGTTTCAGGTTGTGGACAGTTGAGGAAGCGTTTCTTCACAAATGACCTCTTGCTTGGTGCCAGA
GATTGATACTGAGAATGTAGGAGAGAATAGAGCAGAATCCATTCATATGTAACACCCTTAGCAGAGTANCAGGGAAGACT
TGGTAAAGTTCTTTTGGTTGGGAGTACCTGCAANAGGGAATCTCTTTCAGTTCCAAAATGGCTGTGTGTAAGCTGCCNAT
GTAATCTCCATGGGTTTTCATTCTAAAATAGTGTCATATCACCAATCAGATTTGCAATGAACTGTGTTCAGATTAAGACT
NGTCTGCTATGTATTTAGCGTGTGTATGTTCGTGTGTCNTGNGTGTATNNANGGTANAGGTNNACATANGGTGTTTTTT
Sequence Type genomic DNA
Unitrap ID UNI24703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69722508..69722985 452
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051730 (Mettl5) NM_029280 methyltransferase like 5 Gene [Source:MGI (curated);Acc:Mettl5-001]

 
Come back to gene ENSMUSG00000051730


For any suggestions or comments, please send an email to unitrap@crg.es