Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14744G3
Clone ID IST14744G3
Vector VICTR76
Project tigm

Sequence tag IST14744G3BBF1
Sequence
AAAGCCCACACCCACCCACAGTGCCACACCTACTCCAAAAAGGCCACACCTATTTGAACAGGGCCACACCTAATAGTTAA
TAGTGCCACTCCCTGGACGGAGCATATACACACAGGAAAACCTTATCTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123273601..123273750 150
NO GENE  


Sequence tag IST14744G3HMF2
Sequence
GAGTGCCTGCCTAGCATGCATACAAAGCCTCGAGTTTGATCCCAAACACCCCATAAAACTGGGTGTGATGGTCACTCTTG
ATGTCCCAGCACTGGGAAGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI8149

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 27806891..27806993 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019889 (Ptprk) NM_008983 protein tyrosine phosphatase, receptor type, K Gene [Source:MGI Symbol;Acc:MGI:103310]

 
Come back to gene ENSMUSG00000019889


For any suggestions or comments, please send an email to unitrap@crg.es