Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14979F6
Clone ID IST14979F6
Vector VICTR76
Project tigm

Sequence tag IST14979F6HMR1
Sequence
TTCCATGCACAGATTTGCAACAGTTAGTCTAACCCTTCTTCAACTGATAGACTATTGGATGATTTCCTTTCCTATTTCCT
AAAGCTACTGTGACCATTCACATATAAGCTTTGTGTGACACATATCTCCCCAGCCC
Sequence Type genomic DNA
Unitrap ID UNI15084

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 12345019..12345153 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020173 (Cobl) NM_172496 cordon-bleu Gene [Source:MGI (curated);Acc:Cobl-003]


Sequence tag IST14979F6HMF1
Sequence
ATCTCACCTCTGTAGTGGTTAGGACCGGAAGGACCACATCACGCTCTGCAATACTTANAGGTACTGTGTAAAATGCTGAG
CATGAGCTGTGAAGGGAAAGTGGACTCACTGATAGGTGGTGAAGCTGCAGGTTTTCAATACAGTGAGTTCAGAGGTGCAG
ACTCAGGAAGTACTGGGATGGGGATTCCAGTTGTACAGCCAGCTCTTCCTTAGGTTTTCATGGTGGCTGANTGAGCTCTG
CTTCTTGAGAAAAGACCTGATGTCTTCTCCACCTTGCTTATTAGCANAGTCCAGCAGGATAGAGATCCATTGGTCTCCTG
TCNTAGGCCCTGCANTACCTANCTTCATACCTGCANCCCTTCCTCCCTTCTTCTCCTATTGGAACNNANNAAACTGCNTC
CTANGANGATAGTTTTNANNTTGCCTGTCTTGAANANNGANGGTNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020173


For any suggestions or comments, please send an email to unitrap@crg.es