Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14112D3
Clone ID IST14112D3
Vector VICTR74
Project tigm

Sequence tag IST14112D3HMR1
Sequence
TTANTATGAATGCTCACTGGGTACCTGTAGAAGCAAGCAAGCAAGCAAGGCGAGTTGGATCCTTTGGAACTTCAGTTACA
AGTGGTTGTTAGTCATCTGGGTGCTGGGAATTGAACTTGTGACACTGTTAACGGTTC
Sequence Type genomic DNA
Unitrap ID UNI9642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140846229..140846360 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029560 (Snx8) NM_172277 sorting nexin 8 Gene [Source:MGI Symbol;Acc:MGI:2443816]


Sequence tag IST14112D3BBF1
Sequence
CTTGTTGACAAAATATTCACACGTATAAACATTTCCTTTANCTTTAATAAAATTAAAATAAACAGAAACCTCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140846361..140846434 72
NO GENE  

 
Come back to gene ENSMUSG00000029560


For any suggestions or comments, please send an email to unitrap@crg.es