Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12282C6
Clone ID IST12282C6
Vector VICTR76
Project tigm

Sequence tag IST12282C6HMF2
Sequence
AGACTTGGTGCCCGGCCCTTTAAAAGATGATAGGAATTGTTCTTTGAACTACCTTCCCCAGGCCCTCTCTTTTTATATAT
AAGCCACAGTTATTTTTGATAATTTCTTCTGAACTACTTCTAAAAGTGTCAGTAACATAGGTCTTTGGAAAGCTTTTAAA
CGGCCTTCTTCTACTGCCTCGCTGCTATAACACAACACCTAATATTAGTAATTATACATATAAAAATAGTTGCACGAGTC
ACTTTTCATTGCTATGACAAAATGCTCGAGCAAATCAACTTAAAAAGAGGAATGGTTTTTTGGGGGGGGGCTCATGGTTT
CAAAGGCATCCAGCTGCAGTCANATGGCTCCACAGCTTTTAAACCTCTGGCAAAACCATCACAGCANAAAGGTACGGTAA
AGGGAAGTGGA
Sequence Type genomic DNA
Unitrap ID UNI10517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73611576..73611985 404
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070733 (Fryl) NM_177136 furry homolog-like (Drosophila) Gene [Source:MGI (curated);Acc:Fryl-001]


Sequence tag IST12282C6BBF1
Sequence
ATGCTATTTTATACTGCTCATCTGTTGTGTATTTGACTAGCTGATACAGAGTTTGAGGCTACTGGAGATTTATTTAGTTT
GTGTAGGGGCATGCATCACTGCTGCCTGGCTTGTGGTTTTTATTCCTAAAGCCCAGTGCCAAACAGTTTCTGAAGAATTA
TAAAACTTAAATGGCATTGGAAATTAAATTTTGCTGAGTCTTTTTTTAAGTACTTTGTGTGAGAGCCTGAGCATATGCAT
GCTTGACAGGCAGTCGTATGTTTGAGCCGTGGTGGGCATGTGGAGGTCAGAGGACACATATCTATGGTTCATGTGTTCTA
CTGTTGTCAGAGTCTCCTGTTTTGCTGCTGTGTATATAACTGGCTGTAGTGCCTGTGGCAACCTAACGACAGTCTTGANG
GTTTGCTCCTCAGTTGCTTTATTTATTTTTTATTAGATAGAANANGGAAAGAANGAAGGGCTGGCGAGATGGCTCANCAG
CTAANANCACTGATTGCTCTTCCAGANGTCCTGAGTTCNAATGTCNNCAACCACATGGTGN
Sequence Type genomic DNA
Unitrap ID UNI22587

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41103121..41103660 516
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036241 (Ube2r2) NM_026275 ubiquitin-conjugating enzyme E2R 2 Gene [Source:MGI (curated);Acc:Ube2r2-001]

 
Come back to gene ENSMUSG00000036241


For any suggestions or comments, please send an email to unitrap@crg.es