Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A032E05
Clone ID A032E05
Vector pT1betageo
Project ggtc

Sequence tag A032E05
Sequence
GGGCAGGATGCCCTTATGAACCCAACAAGGACCCTTTCAGTGAATGAGAAAAAG
Sequence Type mRNA
Unitrap ID UNI12028

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 5327769..5327820 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069729 (Arid1b) AT rich interactive domain 1B (SWI-like) Gene [Source:MGI (curated);Acc:Arid1b-001]

 
Come back to gene ENSMUSG00000069729


For any suggestions or comments, please send an email to unitrap@crg.es