Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A062D03
Clone ID A062D03
Vector pT1betageo
Project ggtc

Sequence tag A062D03
Sequence
ACACCACTGGCTCTCAGTCTCTGGCCGCATTATTGAATAAATGCAAAACTGCTCAAGGACAAAGATTGGTTAACCAGTGG
ATCAAGCAGCCGCTCATGGATAGGAACAGGATAGAGGAGAGGTTAAATTTAGTGGAAGCTTTTGTCGAGGATTCAGAACT
GAGGCAGAGTTTACAGGAGGATTTGCTTCGCCGGTTTCCAGACCTTAACCGGCTTGCCAAGAAATTCCAGAGACAAGCAG
CGAATTTACAAGACTGTTACCGACTGTATCAGGGTATTAACCAGCTCCCCAGGGTCAGNNNNGCTCTGGACCAGTCCAAA
GGGAGACGCCGGGCACTGATGTTGACAGTCTTTGTGACTCGTCTGATTAATCCTCGTTCTGATAGTTCAAGAAGTCAAGA
AAGGATAGGATCACCTGTAGATATGGNNCAGGTGGAAAACCGCGAGTTCCTTGTAAAACCTTCCTGTGATCCTACCCTGA
GTGACATAACAGAAGTCAAGGATGGCCTGAACAAGAAGATGCAGTCCCCCTTAATCAA
Sequence Type mRNA
Unitrap ID UNI12030

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88085649..88106628 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024151 (Msh2) NM_008628 mutS homolog 2 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:101816]

 
Come back to gene ENSMUSG00000024151


For any suggestions or comments, please send an email to unitrap@crg.es