Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14960F10
Clone ID IST14960F10
Vector VICTR76
Project tigm

Sequence tag IST14960F10BBF1
Sequence
CTCACTACCCCTTAATTCAAGTTCTGCTTGATCAGGTTGGTTTTTATTTGGTGGAGGTTTGTTGTTGTTGTTGTTGTTGT
TTTTTGTTTTANTTTTGTGGTANTGTTAATGTTTTCATTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62397446..62397566 117
NO GENE  


Sequence tag IST14960F10HMF2
Sequence
CTCTTGTCTGGTTTGCTGTGCGATCCCGGGAGTCGGGGGTTGGGGGGGGTGGGGTANTCC
Sequence Type genomic DNA
Unitrap ID UNI23198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75393052..75393110 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000901 (Mmp11) NM_008606 matrix metallopeptidase 11 Gene [Source:MGI (curated);Acc:Mmp11-002]


Sequence tag IST14960F10HMR1
Sequence
NAGAGCTGGGGTTTACCGCCTCTCCTCANAGCTTACCCGTTCCCCGCCAGCTTGGCTCATCTCCAAGATGCACATTCCTA
AGCAGCATTTATGTTTCTAGTGCATTCCCTCTTTCTTAGCTAGCACCCTTCCTCTGGCCTGTCCCCTGTAAGGGACCTGA
CTCACTCTGCCCCACCCTCTGGTCTGGAAGCTGCCAATAGGAAGCCTCAGGCACACTCAAGGGACTCTTGGCTGACCCAT
TCTCCTGGCCTATCTTANACCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75393107..75393367 257
 
EST/CDNA Est Name
  BY014942.1 - BY153138.1 - BY010008.1 - BY793059.1 - BY100700.1

 
Come back to gene BY014942.1 - BY153138.1 - BY010008.1 - BY793059.1 - BY100700.1


For any suggestions or comments, please send an email to unitrap@crg.es