Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14377F1
Clone ID IST14377F1
Vector VICTR74
Project tigm

Sequence tag IST14377F1HMR1
Sequence
GTACTTGCCCCATAGCCCTCACTTGAATGGTGGTTCTCCTTANAAGGCTTGTAGACTTCTATGTCAGGAAGTGATCTGGG
AAAGGACAGGTGGAAGGGCANCAGGGCANCAGGTCCCAGCTTAGCC
Sequence Type genomic DNA
Unitrap ID UNI3537

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7384660..7384784 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024969 (Mark2) NM_001080390 MAP/microtubule affinity-regulating kinase 2 Gene [Source:MGI Symbol;Acc:MGI:99638]


Sequence tag IST14377F1HMF1
Sequence
GTACCAAGGGCCCCAGGGGAGATCTAGTCAAGACCCAAATCTGCCCAAACAAGTTATATAACTCTGAACAAATCACTCTC
CCTCCTAGGACCTGTCTCCACATTGTAAAGGCTCTGAGGCTCTGTCCAGGGTGAATAGAGTACGCGCTCAAGCTTTCTAG
GCCTGGCCCTGAGATGGAGGCAGAAAGTGAGAAGGGGCTGCCTGTCATGAAGCCCACTTCCTGATCTTGGCTAATATCAA
GTGGGCCTGCGAAGAAGCCTGACTCTCGTAGGAGCCTTGCCCAGCATTCTGTGGACACTAGGCCCACACGCTGAAAAATT
TTAGGCTAGGATTGAAAACACTGAAATGAAACATCAATTCTAAACTCAAGGTGTTAAAAGGGTGATTTGTCTCTTTCCAA
AGACTTCATCTGCCCCATCCGCAAACTCCCTGCTCCTCCCANTCANGAATGTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7384781..7385236 452
 
EST/CDNA Est Name
  BG976578.1 - CJ063002.1 - BY752621.1 - BB849884.1 - BY030259.1 - BB841055.1 - BY010462.1 - BY203084.1 - BY209123.1 - BY184264.1 - CJ134252.1 - BB850111.1 - CB193648.1 - BY235545.1 - BY212777.1 - BY221114.1 - BY202205.1 - BY213073.1 - BY214171.1 - BY198903

 
Come back to gene BG976578.1 - CJ063002.1 - BY752621.1 - BB849884.1 - BY030259.1 - BB841055.1 - BY010462.1 - BY203084.1 - BY209123.1 - BY184264.1 - CJ134252.1 - BB850111.1 - CB193648.1 - BY235545.1 - BY212777.1 - BY221114.1 - BY202205.1 - BY213073.1 - BY214171.1 - BY198903


For any suggestions or comments, please send an email to unitrap@crg.es