Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11388F8
Clone ID IST11388F8
Vector VICTR76
Project tigm

Sequence tag IST11388F8BBF1
Sequence
GGATAAGAGCACTGACTGCTTTTCCAGAGGTCTTGAGTCCAATTCCCANCAACCACATGGTGGCTCACAACCATCTGTAA
TAAGATTTGCTGTCATCTTCTGGTGTGTCTCAAGACAGCTGCAATGCACTCACATAAATTAAATTAAATAAATAAATAAA
TAAATAAATAAAATTAAAAAGCATAAAAAAAGTGCTCAAAACAGAGTAAGAAAAAAAAAATNTTNAAAGCANCCNNAAAA
AAAACAAACNNANTTNNNANTNNAATTNTNAAAANAAAACAAGTNATNGGANNNAGGATTNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11388F8HMR1
Sequence
NCCGCTGAGTCNTCTCTCCAGCCCCCCTTTTATGCTTTGAGATAAGGGTGTGTGTATGCTCGCGCTTGTGTGCTTANATC
ATTATTTTTTGAAAGTTTTTTTTTACCTAGTGCCAGGTTTGTTTCTTTTCAGGTANTTTTTGCNGNTGNGTGN
Sequence Type genomic DNA
Unitrap ID UNI5107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154504932..154505082 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038467 (Chmp4b) NM_029362 chromatin modifying protein 4B Gene [Source:MGI (curated);Acc:Chmp4b-001]

 
Come back to gene ENSMUSG00000038467


For any suggestions or comments, please send an email to unitrap@crg.es