Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A061E08
Clone ID A061E08
Vector pT1betageo
Project ggtc

Sequence tag A061E08
Sequence
CCTCCTGCTTTTGGTCAGAGCCCTGGCTTTGGGCAGGGAAGCTCGTGTGTTTGGTGGCACCTCGGCCACTACCTCTACAG
CAGCACCTTCAGGGTTTAGCTTTTGTCAAGCCTCCG
Sequence Type mRNA
Unitrap ID UNI12039

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31890375..31890489 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001855 (Nup214) NM_172268 nucleoporin 214 Gene [Source:MGI (curated);Acc:Nup214-001]

 
Come back to gene ENSMUSG00000001855


For any suggestions or comments, please send an email to unitrap@crg.es