Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11349E11
Clone ID IST11349E11
Vector VICTR76
Project tigm

Sequence tag IST11349E11BBF1
Sequence
GGTAAGAGCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATCTGTAA
CGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI510 UNI4467 UNI32636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10276960..10277048 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 22309070..22309158 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 34803407..34803495 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 90263807..90263895 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4069630..4069718 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022186 (Oxct1) NM_024188 3-oxoacid CoA transferase 1 Gene [Source:MGI Symbol;Acc:MGI:1914291]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114789597..114789685 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042348 (Arl15) NM_172595 ADP-ribosylation factor-like 15 Gene [Source:MGI Symbol;Acc:MGI:2442308]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 84916184..84916272 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6107854..6107942 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 12884764..12884852 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56229012..56229100 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 60612792..60612880 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26022170..26022258 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 39381315..39381403 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16838625..16838713 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 20519073..20519161 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4543735..4543823 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 94624265..94624353 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71183120..71183208 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29766602..29766690 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026790 (Odf2) NM_013615 outer dense fiber of sperm tails 2 Gene [Source:MGI (curated);Acc:Odf2-002]

 
Come back to gene ENSMUSG00000026790


For any suggestions or comments, please send an email to unitrap@crg.es